Skip to main content

pX330-Venus-DNAJC5-Exon 4-gRNA
(Plasmid #205726)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205726 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330-Venus
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA targeting DNAJC5 exon 4
  • gRNA/shRNA sequence
    CACCGGAGGCCGCAGAAGACAAACA
  • Species
    H. sapiens (human)
  • Entrez Gene
    DNAJC5 (a.k.a. CLN4, CLN4B, CSP, DNAJC5A, NCL, mir-941-2, mir-941-3, mir-941-4, mir-941-5)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-Venus-DNAJC5-Exon 4-gRNA was a gift from Randy Schekman (Addgene plasmid # 205726)
  • For your References section:

    Unconventional secretion of alpha-synuclein mediated by palmitoylated DNAJC5 oligomers. Wu S, Hernandez Villegas NC, Sirkis DW, Thomas-Wright I, Wade-Martins R, Schekman R. Elife. 2023 Jan 10;12:e85837. doi: 10.7554/eLife.85837. 10.7554/eLife.85837 PubMed 36626307