pLV-CMV-dnMCAK
(Plasmid
#205993)
-
PurposeOver-expression of GFP-dnMCAK
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 205993 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLVX
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 8134
- Total vector size (bp) 11053
-
Modifications to backboneReplaced the tight-TRE-promoter by the CMV-promoter
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namednMCAK
-
Alt namedominant-negative mutant Kif2C
-
SpeciesCricetulus griseus
-
Insert Size (bp)2157
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer AAGCGCCTCCCCTACCCGGT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBakhoum, S. F.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Dominant-negative MCAK mutant reported in Bakhoum, S. F. et al. Chromosomal instability drives metastasis through a cytosolic DNA response. Nature 553, 467–472 (2018). https://pubmed.ncbi.nlm.nih.gov/29342134/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-CMV-dnMCAK was a gift from Floris Foijer (Addgene plasmid # 205993 ; http://n2t.net/addgene:205993 ; RRID:Addgene_205993) -
For your References section:
cGAS-STING drives the IL-6-dependent survival of chromosomally instable cancers. Hong C, Schubert M, Tijhuis AE, Requesens M, Roorda M, van den Brink A, Ruiz LA, Bakker PL, van der Sluis T, Pieters W, Chen M, Wardenaar R, van der Vegt B, Spierings DCJ, de Bruyn M, van Vugt MATM, Foijer F. Nature. 2022 Jul;607(7918):366-373. doi: 10.1038/s41586-022-04847-2. Epub 2022 Jun 15. 10.1038/s41586-022-04847-2 PubMed 35705809