Skip to main content
Addgene

pLV-CMV-KIF2C
(Plasmid #205994)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205994 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLVX
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 8134
  • Total vector size (bp) 11089
  • Modifications to backbone
    Replaced pTight-promoter by CMV-promoter
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KIF2c
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2178
  • GenBank ID
    NM_006845.4
  • Entrez Gene
    KIF2C (a.k.a. CT139, KNSL6, MCAK)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer AAGCGCCTCCCCTACCCGGT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Bakhoum, S. F.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Bakhoum, S. F. et al. Chromosomal instability drives metastasis through a cytosolic DNA
response. Nature 553, 467–472 (2018).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-CMV-KIF2C was a gift from Floris Foijer (Addgene plasmid # 205994 ; http://n2t.net/addgene:205994 ; RRID:Addgene_205994)
  • For your References section:

    cGAS-STING drives the IL-6-dependent survival of chromosomally instable cancers. Hong C, Schubert M, Tijhuis AE, Requesens M, Roorda M, van den Brink A, Ruiz LA, Bakker PL, van der Sluis T, Pieters W, Chen M, Wardenaar R, van der Vegt B, Spierings DCJ, de Bruyn M, van Vugt MATM, Foijer F. Nature. 2022 Jul;607(7918):366-373. doi: 10.1038/s41586-022-04847-2. Epub 2022 Jun 15. 10.1038/s41586-022-04847-2 PubMed 35705809