Skip to main content
Addgene

pMVS1111A:PhmtB-bgaB
(Plasmid #205998)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205998 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMVS-V1
  • Backbone size w/o insert (bp) 8226
  • Total vector size (bp) 10403

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    thermostable beta-galactosidase
  • Alt name
    bgaB
  • Insert Size (bp)
    2177
  • Promoter PhmtB

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer CCCCATAACATCGGCACAGTAC
  • 3′ sequencing primer CCTGGCTGGGGTTAATAAATGTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMVS1111A:PhmtB-bgaB was a gift from Bastian Molitor (Addgene plasmid # 205998 ; http://n2t.net/addgene:205998 ; RRID:Addgene_205998)
  • For your References section:

    A Shuttle-Vector System Allows Heterologous Gene Expression in the Thermophilic Methanogen Methanothermobacter thermautotrophicus DeltaH. Fink C, Beblawy S, Enkerlin AM, Muhling L, Angenent LT, Molitor B. mBio. 2021 Dec 21;12(6):e0276621. doi: 10.1128/mBio.02766-21. Epub 2021 Nov 23. 10.1128/mBio.02766-21 PubMed 34809461