pMVS1111A:PhmtB-bgaB
(Plasmid
#205998)
-
PurposeConjugative shuttle vector for Escherichia coli and Methanothermobacter thermautotrophicus encoding beta-galactosidase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205998 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMVS-V1
- Backbone size w/o insert (bp) 8226
- Total vector size (bp) 10403
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namethermostable beta-galactosidase
-
Alt namebgaB
-
Insert Size (bp)2177
- Promoter PhmtB
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer CCCCATAACATCGGCACAGTAC
- 3′ sequencing primer CCTGGCTGGGGTTAATAAATGTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMVS1111A:PhmtB-bgaB was a gift from Bastian Molitor (Addgene plasmid # 205998 ; http://n2t.net/addgene:205998 ; RRID:Addgene_205998) -
For your References section:
A Shuttle-Vector System Allows Heterologous Gene Expression in the Thermophilic Methanogen Methanothermobacter thermautotrophicus DeltaH. Fink C, Beblawy S, Enkerlin AM, Muhling L, Angenent LT, Molitor B. mBio. 2021 Dec 21;12(6):e0276621. doi: 10.1128/mBio.02766-21. Epub 2021 Nov 23. 10.1128/mBio.02766-21 PubMed 34809461