pMVS1111A:PhmtB-bgaB
(Plasmid #205998)

• Purpose: Conjugative shuttle vector for Escherichia coli and Methanothermobacter thermautotrophicus encoding beta-galactosidase
• Depositing Lab: Bastian Molitor
• Publication: Fink et al mBio. 2021 Dec 21;12(6):e0276621. doi: 10.1128/mBio.02766-21. Epub 2021 Nov 23.

Backbone

• Vector backbone: pMVS-V1
• Backbone size w/o insert (bp): 8226
• Total vector size (bp): 10403

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: thermostable beta-galactosidase
• Alt name: bgaB
• Insert Size (bp): 2177
• Promoter: PhmtB

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: CCCCATAACATCGGCACAGTAC
• 3′ sequencing primer: CCTGGCTGGGGTTAATAAATGTTG

Resource Information

• Supplemental Documents:
  • pMVS1111A-PhmtB_bgaB.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry