Skip to main content

pFN18A-HaloTag-SpyCatcher
(Plasmid #206041)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206041 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFN18A
  • Backbone manufacturer
    Promega Corporation
  • Backbone size (bp) 6158
  • Modifications to backbone
    Deletion of Barnase gene, insertion of Spy0128 at either side of restriction sites BspEI and NheI, addition of SpyCatcher-8X His-Tag at C-terminus.
  • Vector type
    Bacterial Expression
  • Promoter T7
  • Tags / Fusion Proteins
    • HaloTag (N terminal on backbone)
    • SpyCatcher-8His (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CGGGTCTGAATCTGCTGCAAG
  • 3′ sequencing primer CTTCCTTTCGGGCTTTGTTAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Professor Julio Fernandez

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFN18A-HaloTag-SpyCatcher was a gift from Sergi Garcia-Manyes (Addgene plasmid # 206041 ; http://n2t.net/addgene:206041 ; RRID:Addgene_206041)
  • For your References section:

    Single-molecule magnetic tweezers to probe the equilibrium dynamics of individual proteins at physiologically relevant forces and timescales. Tapia-Rojo R, Mora M, Garcia-Manyes S. Nat Protoc. 2024 Mar 11. doi: 10.1038/s41596-024-00965-5. 10.1038/s41596-024-00965-5 PubMed 38467905