pFN18A-HaloTag-SpyCatcher
(Plasmid
#206041)
-
Purpose(Empty Backbone) HaloTag-Spy0128-(Protein of Interest)-Spy0128-SpyCatcher-8xHisTag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206041 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFN18A
-
Backbone manufacturerPromega Corporation
- Backbone size (bp) 6158
-
Modifications to backboneDeletion of Barnase gene, insertion of Spy0128 at either side of restriction sites BspEI and NheI, addition of SpyCatcher-8X His-Tag at C-terminus.
-
Vector typeBacterial Expression
- Promoter T7
-
Tags
/ Fusion Proteins
- HaloTag (N terminal on backbone)
- SpyCatcher-8His (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CGGGTCTGAATCTGCTGCAAG
- 3′ sequencing primer CTTCCTTTCGGGCTTTGTTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byProfessor Julio Fernandez
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFN18A-HaloTag-SpyCatcher was a gift from Sergi Garcia-Manyes (Addgene plasmid # 206041 ; http://n2t.net/addgene:206041 ; RRID:Addgene_206041) -
For your References section:
Single-molecule magnetic tweezers to probe the equilibrium dynamics of individual proteins at physiologically relevant forces and timescales. Tapia-Rojo R, Mora M, Garcia-Manyes S. Nat Protoc. 2024 Mar 11. doi: 10.1038/s41596-024-00965-5. 10.1038/s41596-024-00965-5 PubMed 38467905