Skip to main content
Addgene
Open Menu

Cav2.2 pcDNA3
(Plasmid #206072)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206072 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen Life Technologies
  • Backbone size w/o insert (bp) 5446
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cacna1b
  • Alt name
    Cav2.2 alpha1B
  • Species
    O. cuniculus (rabbit)
  • Insert Size (bp)
    7094
  • Entrez Gene
    CACNA1B
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CTGGCTAACTAGAGAACC
  • 3′ sequencing primer GCATTTAGGTGACACTATAG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Yasuo Mori

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' end of DNA is very GC rich

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cav2.2 pcDNA3 was a gift from Annette Dolphin (Addgene plasmid # 206072 ; http://n2t.net/addgene:206072 ; RRID:Addgene_206072)

  • For your References section:

    Dominant-negative calcium channel suppression by truncated constructs involves a kinase implicated in the unfolded protein response. Page KM, Heblich F, Davies A, Butcher AJ, Leroy J, Bertaso F, Pratt WS, Dolphin AC. J Neurosci. 2004 Jun 9;24(23):5400-9. doi: 10.1523/JNEUROSCI.0553-04.2004. 10.1523/JNEUROSCI.0553-04.2004 PubMed 15190113
Related items:
Commonly requested with: