Cav2.2 HA EIVK (E1658K) pCAGGS
(Plasmid
#206096)
-
Purposeexpression of rabbit Cav2.2 calcium channel with an exofacial double HA tag in domain II and an E1658K mutation in the P loop of Domain IV which abolishes trafficking to the cell surface
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206096 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGGS
-
Backbone manufacturerPMID 11397804
- Backbone size w/o insert (bp) 4890
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecacna1b
-
Alt nameCav2.2 alpha1B
-
SpeciesO. cuniculus (rabbit)
-
Insert Size (bp)7160
-
MutationE1658K
-
Entrez GeneCACNA1B
- Promoter CMV/B-actin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CTCTGCTAACCATGTTCATGC
- 3′ sequencing primer CTGATAGGCAGCCTGCACCTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byYasuo Mori
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' end of DNA is very GC rich
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cav2.2 HA EIVK (E1658K) pCAGGS was a gift from Annette Dolphin (Addgene plasmid # 206096 ; http://n2t.net/addgene:206096 ; RRID:Addgene_206096) -
For your References section:
Disruption of the Key Ca(2+) Binding Site in the Selectivity Filter of Neuronal Voltage-Gated Calcium Channels Inhibits Channel Trafficking. Meyer JO, Dahimene S, Page KM, Ferron L, Kadurin I, Ellaway JIJ, Zhao P, Patel T, Rothwell SW, Lin P, Pratt WS, Dolphin AC. Cell Rep. 2019 Oct 1;29(1):22-33.e5. doi: 10.1016/j.celrep.2019.08.079. 10.1016/j.celrep.2019.08.079 PubMed 31577951