Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

An R57A, R59A HA CAAX pMT2
(Plasmid #206126)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 206126 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMT2
  • Backbone manufacturer
    Genetics Institute Inc
  • Backbone size w/o insert (bp) 5163
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cacna1a
  • Alt name
    Cav2.1 alpha1A
  • Species
    R. norvegicus (rat)
  • Mutation
    R57A, R59A
  • Entrez Gene
    Cacna1a (a.k.a. BccA1, Cav2.1, rbA-1)
  • Promoter Ad MLP/TPL/SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer AGCTTGAGGTGTGGCAGGCTT
  • 3′ sequencing primer GGTCGAACCATGATGGCAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Terry P. Snutch

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    An R57A, R59A HA CAAX pMT2 was a gift from Annette Dolphin (Addgene plasmid # 206126 ; http://n2t.net/addgene:206126 ; RRID:Addgene_206126)
  • For your References section:

    N terminus is key to the dominant negative suppression of Ca(V)2 calcium channels: implications for episodic ataxia type 2. Page KM, Heblich F, Margas W, Pratt WS, Nieto-Rostro M, Chaggar K, Sandhu K, Davies A, Dolphin AC. J Biol Chem. 2010 Jan 8;285(2):835-44. doi: 10.1074/jbc.M109.065045. Epub 2009 Nov 10. 10.1074/jbc.M109.065045 PubMed 19903821