An R57A, R59A HA CAAX pMT2
(Plasmid
#206126)
-
PurposeCav2.1 N-terminus (amino acids 1-100) with R57A and R59A mutations that prevent dominant-negative suppression of Cav2.1 currents and a C-terminal CAAX (last 10 aa of H.Ras) motif and a HA tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206126 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMT2
-
Backbone manufacturerGenetics Institute Inc
- Backbone size w/o insert (bp) 5163
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecacna1a
-
Alt nameCav2.1 alpha1A
-
SpeciesR. norvegicus (rat)
-
MutationR57A, R59A
-
Entrez GeneCacna1a (a.k.a. BccA1, Cav2.1, rbA-1)
- Promoter Ad MLP/TPL/SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer AGCTTGAGGTGTGGCAGGCTT
- 3′ sequencing primer GGTCGAACCATGATGGCAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTerry P. Snutch
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
An R57A, R59A HA CAAX pMT2 was a gift from Annette Dolphin (Addgene plasmid # 206126 ; http://n2t.net/addgene:206126 ; RRID:Addgene_206126) -
For your References section:
N terminus is key to the dominant negative suppression of Ca(V)2 calcium channels: implications for episodic ataxia type 2. Page KM, Heblich F, Margas W, Pratt WS, Nieto-Rostro M, Chaggar K, Sandhu K, Davies A, Dolphin AC. J Biol Chem. 2010 Jan 8;285(2):835-44. doi: 10.1074/jbc.M109.065045. Epub 2009 Nov 10. 10.1074/jbc.M109.065045 PubMed 19903821