PGK mScarlet-Synaptophysin
(Plasmid
#206145)
-
PurposePGK mScarlet-Synaptophysin
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206145 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePGK mScarlet
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 6200
-
Modifications to backboneModified from pEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesynaptophysin
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1500
-
Entrez GeneSyp (a.k.a. Syp1)
- Promoter PGK
-
Tag
/ Fusion Protein
- mScarlet (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer 5’- CACCTACAAGGCCAAGAAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGK mScarlet-Synaptophysin was a gift from Erika Holzbaur (Addgene plasmid # 206145)