PGK mScarlet-Synaptophysin
(Plasmid
#206145)
-
PurposePGK mScarlet-Synaptophysin
-
Depositing Lab
-
Depositing OrganizationUniversity of Pennsylvania
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206145 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 206145-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 206145-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePGK mScarlet
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 6200
-
Modifications to backboneModified from pEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesynaptophysin
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1500
-
Entrez GeneSyp (a.k.a. Syp1)
- Promoter PGK
-
Tag
/ Fusion Protein
- mScarlet (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer 5’- CACCTACAAGGCCAAGAAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 206145-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 206145-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PGK mScarlet-Synaptophysin was a gift from Erika Holzbaur (Addgene plasmid # 206145 ; http://n2t.net/addgene:206145 ; RRID:Addgene_206145) -
For your References section:
RAB3 phosphorylation by pathogenic LRRK2 impairs trafficking of synaptic vesicle precursors. Dou D, Aiken J, Holzbaur ELF. J Cell Biol. 2024 Jun 3;223(6):e202307092. doi: 10.1083/jcb.202307092. Epub 2024 Mar 21. 10.1083/jcb.202307092 PubMed 38512027