Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more


CMV SNAP-Synapsin
(Plasmid #206152)


Item Catalog # Description Quantity Price (USD)
Plasmid 206152 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
    pEGFP-C3 Synapsin
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 6500
  • Modifications to backbone
    replaced EGFP with SNAPf
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Insert Size (bp)
  • Promoter CMV
  • Tag / Fusion Protein
    • SNAPf (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site XnoI (filled-in) / BamHi (filled-in); XhoI restored (unknown if destroyed)
  • 5′ sequencing primer 5’ - GAAATCCCGTGCCCATTCTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pSNAPf Vector from NEB

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV SNAP-Synapsin was a gift from Erika Holzbaur (Addgene plasmid # 206152)