pTRE/VEGF/IRES/EGFP
(Plasmid
#206211)
-
PurposeAn expression vector of VEGF and EGFP under control of TRE promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206211 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneFUGW
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namevascular endothelial growth factor
-
Alt nameVEGF
-
SpeciesM. musculus (mouse)
-
Entrez GeneVegfa (a.k.a. L-VEGF, Vegf, Vpf)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer CCTCACATTGCCAAAAGACG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRE/VEGF/IRES/EGFP was a gift from Masamichi Kamihira (Addgene plasmid # 206211 ; http://n2t.net/addgene:206211 ; RRID:Addgene_206211) -
For your References section:
Hypoxia-responsive expression of vascular endothelial growth factor for induction of angiogenesis in artificial three-dimensional tissues. Masumoto S, Ono A, Ito A, Kawabe Y, Kamihira M. J Biosci Bioeng. 2021 Oct;132(4):399-407. doi: 10.1016/j.jbiosc.2021.06.010. Epub 2021 Aug 4. 10.1016/j.jbiosc.2021.06.010 PubMed 34364783