PB/pHSP-tTA-TRE-tTA-pEF1α-PuroR
(Plasmid #206213)

• Purpose: PiggyBac-based transposon vector plasmid which encodes an expression unit of tetracycline-responsive transactivator under control of HSP promoter with transcriptional amplification
• Depositing Lab: Masamichi Kamihira
• Publication: Kitano et al Cytotechnology. 2021 Jun;73(3):353-362. doi: 10.1007/s10616-021-00457-4. Epub 2021 Feb 24.

Backbone

• Vector backbone: PB513
• Backbone manufacturer: System Biosciences
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: tetracycline-responsive transactivator
• Alt name: tTA
• Species: Synthetic

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (unknown if destroyed)
• 3′ cloning site: NheI (unknown if destroyed)
• 5′ sequencing primer: CCCAGTCACGACGTTGTAAAACG
• 3′ sequencing primer: AGCGGATAACAATTTCACACAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry