Skip to main content

MSCV-JAK3(M511)_IRES_GFP
(Plasmid #206290)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206290 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MSCV-IRES-GFP
  • Total vector size (bp) 9841
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    JAK3 (M511I)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3375
  • Mutation
    Methionine 511 to Isoleucine

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCCTCGATCCTCCCTTTATC
  • 3′ sequencing primer ACGCACACCGGCCTTATTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-JAK3(M511)_IRES_GFP was a gift from Charles de Bock (Addgene plasmid # 206290 ; http://n2t.net/addgene:206290 ; RRID:Addgene_206290)
  • For your References section:

    In vitro and in vivo modelling of mutant JAK3/STAT5 signaling in leukemia. Omari SA, Kosasih HJ, Chung T, de Bock CE. Heliyon. 2023 Nov 8;9(11):e22085. doi: 10.1016/j.heliyon.2023.e22085. eCollection 2023 Nov. 10.1016/j.heliyon.2023.e22085 PubMed 38053908