MSCV-JAK3(M511)_IRES_GFP
(Plasmid
#206290)
-
PurposeExpression of mutant JAK3 (M511I) that is able to drive constitutive activation of the JAK/STAT pathway
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206290 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneMSCV-IRES-GFP
- Total vector size (bp) 9841
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameJAK3 (M511I)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3375
-
MutationMethionine 511 to Isoleucine
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GCCTCGATCCTCCCTTTATC
- 3′ sequencing primer ACGCACACCGGCCTTATTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-JAK3(M511)_IRES_GFP was a gift from Charles de Bock (Addgene plasmid # 206290 ; http://n2t.net/addgene:206290 ; RRID:Addgene_206290) -
For your References section:
In vitro and in vivo modelling of mutant JAK3/STAT5 signaling in leukemia. Omari SA, Kosasih HJ, Chung T, de Bock CE. Heliyon. 2023 Nov 8;9(11):e22085. doi: 10.1016/j.heliyon.2023.e22085. eCollection 2023 Nov. 10.1016/j.heliyon.2023.e22085 PubMed 38053908