AAV-AM
(Plasmid
#206513)
-
PurposeAAV packaging vector containing AAV2 rep and AM cap and partial AAV2 p5 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206513 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV2 rep, partial p5 in generic backbone
- Backbone size w/o insert (bp) 5119
- Total vector size (bp) 7333
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable ;
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAM capsid
-
Speciesadeno-associated virus
-
Insert Size (bp)2214
- Promoter p5
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Swa I (not destroyed)
- 3′ cloning site Age I (not destroyed)
- 5′ sequencing primer TGGATGACTGCATCTTTGAA
- 3′ sequencing primer GCAGGTTTAAACGAATTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-AM was a gift from Mark Kay (Addgene plasmid # 206513 ; http://n2t.net/addgene:206513 ; RRID:Addgene_206513) -
For your References section:
The AAV capsid can influence the epigenetic marking of rAAV delivered episomal genomes in a species dependent manner. Gonzalez-Sandoval A, Pekrun K, Tsuji S, Zhang F, Hung KL, Chang HY, Kay MA. Nat Commun. 2023 Apr 28;14(1):2448. doi: 10.1038/s41467-023-38106-3. 10.1038/s41467-023-38106-3 PubMed 37117181