pAAV-CMV-TadA7.10-SpG N aa2-713-InteinN
(Plasmid
#206967)
-
PurposeExpresses TadA7.10 and SpG cas9N by the constitutive CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206967 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-SMVP-Cas9N
- Backbone size w/o insert (bp) 3876
- Total vector size (bp) 7766
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCMV, TadA7.10, SpG N
-
Alt nameTadA7.10, Split-SpG N-terminal half and CMV
-
SpeciesSynthetic
-
Insert Size (bp)3839
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggaatgtgtgtcagttagggt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byaddgene 140002:pCMV-T7-ABEmax(7.10)-SpG-P2A-EGFP (RTW4562)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CMV-TadA7.10-SpG N aa2-713-InteinN was a gift from Yuxuan Guo (Addgene plasmid # 206967 ; http://n2t.net/addgene:206967 ; RRID:Addgene_206967) -
For your References section:
Adenine base editor-based correction of the cardiac pathogenic Lmna c.1621C > T mutation in murine hearts. Yang L, Liu Z, Sun J, Chen Z, Gao F, Guo Y. J Cell Mol Med. 2024 Feb;28(4):e18145. doi: 10.1111/jcmm.18145. 10.1111/jcmm.18145 PubMed 38332517