Skip to main content

A3Bmax
(Plasmid #207167)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207167 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    BE4max
  • Backbone size w/o insert (bp) 8007
  • Total vector size (bp) 10000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Apolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B
  • Alt name
    APOBEC3
  • Alt name
    A3B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2048
  • GenBank ID
    NM_004900
  • Entrez Gene
    APOBEC3B (a.k.a. A3B, APOBEC1L, ARCD3, ARP4, DJ742C19.2, PHRBNL, bK150C2.2)
  • Promoter CMV
  • Tags / Fusion Proteins
    • NLS, 6x His (C terminal on insert)
    • NLS (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer tagaaggcacagtcgagg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Additional important insert: Cas9n-UGI-UGI-NLS

Please note: Plasmid contains an E198K mutation in Cas9. This mutation is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    A3Bmax was a gift from Reuben Harris (Addgene plasmid # 207167 ; http://n2t.net/addgene:207167 ; RRID:Addgene_207167)
  • For your References section:

    APOBEC Reporter Systems for Evaluating diNucleotide Editing Levels. Rieffer AE, Chen Y, Salamango DJ, Moraes SN, Harris RS. CRISPR J. 2023 Oct;6(5):430-446. doi: 10.1089/crispr.2023.0027. Epub 2023 Sep 6. 10.1089/crispr.2023.0027 PubMed 37672599