pFUW-TetO-NFATC2
(Plasmid
#207191)
-
Purposedoxycycline-inducible expression of Human NFATC2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207191 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFUW-TetO
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepFUW-TetO-NFATC2
-
SpeciesH. sapiens (human)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site BstBI (unknown if destroyed)
- 5′ sequencing primer TCCACGCTGTTTTGACCTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUW-TetO-NFATC2 was a gift from Filipe Pereira (Addgene plasmid # 207191 ; http://n2t.net/addgene:207191 ; RRID:Addgene_207191) -
For your References section:
Anchored screening identifies transcription factor blueprints underlying dendritic cell diversity and subset-specific anti-tumor immunity. Henriques-Oliveira L, Altman AR, Kurochkin I, Ascic E, Halitzki E, Matei A, Pértiga-Cabral D, Ulmert I, Holst S, Nair MS, Cunha PP, Park S, Vergani S, Kharas MG, Yuan J, Lahl K, Rosa FF, Pires CF, Pereira C-F. Immunity. 58, 1-20. October 2025. 10.1016/j.immuni.2025.08.001