Lenti-RNF2-tevopreQ1-epegRNA+5G>T_EF1a-puroR
(Plasmid
#207355)
-
PurposeLentiviral transfer plasmid encoding hU6-driven expression of a RNF2 engineered prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 207355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiCRISPRv2_deltaCas9
-
Backbone manufacturerCarlon lab (M. Bulcaen)
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRNF2 + 5G>T tevopreq1-prime editing guide RNA (epegRNA)
-
gRNA/shRNA sequencegtcatcttagtcattacctg
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-RNF2-tevopreQ1-epegRNA+5G>T_EF1a-puroR was a gift from Marianne Carlon (Addgene plasmid # 207355 ; http://n2t.net/addgene:207355 ; RRID:Addgene_207355) -
For your References section:
Prime editing functionally corrects cystic fibrosis-causing CFTR mutations in human organoids and airway epithelial cells. Bulcaen M, Kortleven P, Liu RB, Maule G, Dreano E, Kelly M, Ensinck MM, Thierie S, Smits M, Ciciani M, Hatton A, Chevalier B, Ramalho AS, Casadevall I Solvas X, Debyser Z, Vermeulen F, Gijsbers R, Sermet-Gaudelus I, Cereseto A, Carlon MS. Cell Rep Med. 2024 May 21;5(5):101544. doi: 10.1016/j.xcrm.2024.101544. Epub 2024 May 1. 10.1016/j.xcrm.2024.101544 PubMed 38697102