Skip to main content

Lenti-RNF2-tevopreQ1-epegRNA+5G>T_EF1a-puroR
(Plasmid #207355)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207355 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    lentiCRISPRv2_deltaCas9
  • Backbone manufacturer
    Carlon lab (M. Bulcaen)
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RNF2 + 5G>T tevopreq1-prime editing guide RNA (epegRNA)
  • gRNA/shRNA sequence
    gtcatcttagtcattacctg
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-RNF2-tevopreQ1-epegRNA+5G>T_EF1a-puroR was a gift from Marianne Carlon (Addgene plasmid # 207355 ; http://n2t.net/addgene:207355 ; RRID:Addgene_207355)
  • For your References section:

    Prime editing functionally corrects cystic fibrosis-causing CFTR mutations in human organoids and airway epithelial cells. Bulcaen M, Kortleven P, Liu RB, Maule G, Dreano E, Kelly M, Ensinck MM, Thierie S, Smits M, Ciciani M, Hatton A, Chevalier B, Ramalho AS, Casadevall I Solvas X, Debyser Z, Vermeulen F, Gijsbers R, Sermet-Gaudelus I, Cereseto A, Carlon MS. Cell Rep Med. 2024 May 21;5(5):101544. doi: 10.1016/j.xcrm.2024.101544. Epub 2024 May 1. 10.1016/j.xcrm.2024.101544 PubMed 38697102