pS23.U6<ActB.mus_C-term-KI_gRNA
(Plasmid
#207408)
-
PurposegRNA from a U6 promoter targeting the mouse ActB near the 3' end of the ORF. Used for C-terminal knockin by DSB repair. [Lab plasmid ID: TU260]
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207408 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepS23.U6
-
Vector typeMouse Targeting, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameActB
-
Alt nameβ-Actin
-
gRNA/shRNA sequenceagtccgcctagaagcacttg
-
SpeciesM. musculus (mouse)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer acgatacaaggctgttagagaga
- 3′ sequencing primer GCAGGGCAAGATATTACCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2020.07.15.199620 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pS23.U6<ActB.mus_C-term-KI_gRNA was a gift from Alexandros Poulopoulos (Addgene plasmid # 207408 ; http://n2t.net/addgene:207408 ; RRID:Addgene_207408) -
For your References section:
Enhancing Precision and Efficiency of Cas9-Mediated Knockin Through Combinatorial Fusions of DNA Repair Proteins. Richardson RR, Steyert M, Khim SN, Crutcher GW, Brandenburg C, Robertson CD, Romanowski AJ, Inen J, Altas B, Poulopoulos A. CRISPR J. 2023 Oct;6(5):447-461. doi: 10.1089/crispr.2023.0036. Epub 2023 Sep 15. 10.1089/crispr.2023.0036 PubMed 37713292
Map uploaded by the depositor.
