pS23.U6<ActB.mus_C-term-KI_gRNA
(Plasmid
#207408)
-
PurposegRNA from a U6 promoter targeting the mouse ActB near the 3' end of the ORF. Used for C-terminal knockin by DSB repair. [Lab plasmid ID: TU260]
-
Depositing Lab
-
Depositing OrganizationUniversity of Maryland, Baltimore
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207408 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 207408-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 207408-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepS23.U6
-
Vector typeMouse Targeting, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameActB
-
Alt nameβ-Actin
-
gRNA/shRNA sequenceagtccgcctagaagcacttg
-
SpeciesM. musculus (mouse)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer acgatacaaggctgttagagaga
- 3′ sequencing primer GCAGGGCAAGATATTACCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2020.07.15.199620 for bioRxiv preprint.
DNA (Catalog # 207408-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 207408-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pS23.U6<ActB.mus_C-term-KI_gRNA was a gift from Alexandros Poulopoulos (Addgene plasmid # 207408 ; http://n2t.net/addgene:207408 ; RRID:Addgene_207408) -
For your References section:
Enhancing Precision and Efficiency of Cas9-Mediated Knockin Through Combinatorial Fusions of DNA Repair Proteins. Richardson RR, Steyert M, Khim SN, Crutcher GW, Brandenburg C, Robertson CD, Romanowski AJ, Inen J, Altas B, Poulopoulos A. CRISPR J. 2023 Oct;6(5):447-461. doi: 10.1089/crispr.2023.0036. Epub 2023 Sep 15. 10.1089/crispr.2023.0036 PubMed 37713292
Map uploaded by the depositor.
