Skip to main content

pS23.U6<ActB.mus_C-term-KI_gRNA
(Plasmid #207408)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207408 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 207408-D50 50 μg of DNA in Tris buffer $495
DNA 207408-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pS23.U6
  • Vector type
    Mouse Targeting, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ActB
  • Alt name
    β-Actin
  • gRNA/shRNA sequence
    agtccgcctagaagcacttg
  • Species
    M. musculus (mouse)
  • Promoter U6

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer acgatacaaggctgttagagaga
  • 3′ sequencing primer GCAGGGCAAGATATTACCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2020.07.15.199620 for bioRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pS23.U6<ActB.mus_C-term-KI_gRNA was a gift from Alexandros Poulopoulos (Addgene plasmid # 207408 ; http://n2t.net/addgene:207408 ; RRID:Addgene_207408)
  • For your References section:

    Enhancing Precision and Efficiency of Cas9-Mediated Knockin Through Combinatorial Fusions of DNA Repair Proteins. Richardson RR, Steyert M, Khim SN, Crutcher GW, Brandenburg C, Robertson CD, Romanowski AJ, Inen J, Altas B, Poulopoulos A. CRISPR J. 2023 Oct;6(5):447-461. doi: 10.1089/crispr.2023.0036. Epub 2023 Sep 15. 10.1089/crispr.2023.0036 PubMed 37713292