Skip to main content

Halo-TCAB1 HRD
(Plasmid #207535)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207535 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFastBac dual
  • Backbone size w/o insert (bp) 5500
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HaloTag with internal PuroR cassette flanked by human TCAB1 locus sequences
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    3460
  • Promoter Endogenous
  • Tag / Fusion Protein
    • HaloTag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTTTAAAAAACCTCCCACACCTC
  • 3′ sequencing primer AAA CCA CAA CTA GAA TGC AGT GA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Halo-TCAB1 HRD was a gift from Jens Schmidt (Addgene plasmid # 207535 ; http://n2t.net/addgene:207535 ; RRID:Addgene_207535)
  • For your References section:

    TCAB1 prevents nucleolar accumulation of the telomerase RNA to facilitate telomerase assembly. Klump BM, Perez GI, Patrick EM, Adams-Boone K, Cohen SB, Han L, Yu K, Schmidt JC. Cell Rep. 2023 Jun 1;42(6):112577. doi: 10.1016/j.celrep.2023.112577. 10.1016/j.celrep.2023.112577 PubMed 37267110
Commonly requested with: