N-terminal Halo-XLF
(Plasmid
#207546)
-
PurposeHomologous recombination donor to insert halo tag at the N terminal of the endogenous XLF locus.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207546 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330 Addgene #42230
- Backbone size w/o insert (bp) 8484
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHaloTag with internal PuroR cassette flanked by human Lig4 locus sequences
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2972
-
Tag
/ Fusion Protein
- HaloTag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCCTGAGAGTTGGATAGCTGT
- 3′ sequencing primer CTGCCTTGGGCAAGATTAAATCAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
N-terminal Halo-XLF was a gift from Jens Schmidt (Addgene plasmid # 207546 ; http://n2t.net/addgene:207546 ; RRID:Addgene_207546) -
For your References section:
Single-molecule imaging reveals the kinetics of non-homologous end-joining in living cells. Mikhova M, Goff NJ, Janovic T, Heyza JR, Meek K, Schmidt JC. Nat Commun. 2024 Nov 23;15(1):10159. doi: 10.1038/s41467-024-54545-y. 10.1038/s41467-024-54545-y PubMed 39578493