GW1-ARSeNL
(Plasmid
#207873)
-
PurposeMammalian expression of the BRET ATP sensor
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneGW1
- Backbone size w/o insert (bp) 5271
- Total vector size (bp) 6873
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameARSeNL
-
Alt namemScarlet-BsEpsilon-NanoLuc
-
SpeciesSynthetic
-
Insert Size (bp)1602
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGAATCGGAGTGAGTGC
- 3′ sequencing primer CAAATGTGGTATGGCTGATT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GW1-ARSeNL was a gift from Mathew Tantama (Addgene plasmid # 207873 ; http://n2t.net/addgene:207873 ; RRID:Addgene_207873) -
For your References section:
Ratiometric BRET Measurements of ATP with a Genetically-Encoded Luminescent Sensor. Min SH, French AR, Trull KJ, Tat K, Varney SA, Tantama M. Sensors (Basel). 2019 Aug 10;19(16). pii: s19163502. doi: 10.3390/s19163502. 10.3390/s19163502 PubMed 31405152