pGL3-NBRE3
(Plasmid
#208254)
-
PurposepGL3 promoter luciferase reporter vector containing 3 copies of the NBRE DNA response element (5′-GAGTTTTAAAAGGTCATGCTCAATT TGTC-3′) used for luciferase reporter assays in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208254 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3-promoter
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5010
- Total vector size (bp) 5090
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3X NBRE-LUC
-
Alt nameNGFI-B (Nerve Growth Factor-Induced Gene-B) Response
-
SpeciesH. sapiens (human)
- Promoter SV40 early promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe plasmids were cloned in the Kojetin lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-NBRE3 was a gift from Douglas Kojetin (Addgene plasmid # 208254 ; http://n2t.net/addgene:208254 ; RRID:Addgene_208254) -
For your References section:
Assessment of NR4A Ligands That Directly Bind and Modulate the Orphan Nuclear Receptor Nurr1. Munoz-Tello P, Lin H, Khan P, de Vera IMS, Kamenecka TM, Kojetin DJ. J Med Chem. 2020 Dec 24;63(24):15639-15654. doi: 10.1021/acs.jmedchem.0c00894. Epub 2020 Dec 8. 10.1021/acs.jmedchem.0c00894 PubMed 33289551