BcLOV-mCh-EGFR
(Plasmid
#208274)
-
PurposeExpresses BcLOV-EGFR for optogenetic activation of EGFR signaling. Includes an mCherry tag.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208274 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePHR
- Backbone size w/o insert (bp) 10000
- Total vector size (bp) 14000
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBcLOV-mCherry-EGFR
-
SpeciesH. sapiens (human); Botrytis cinerea
-
Insert Size (bp)4179
- Promoter pCMV
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGACTTTCCAAAATGTCGTAACAACTCC
- 3′ sequencing primer acagcaaccaggatttatacaaggagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BcLOV-mCh-EGFR was a gift from Lukasz Bugaj (Addgene plasmid # 208274 ; http://n2t.net/addgene:208274 ; RRID:Addgene_208274) -
For your References section:
Optogenetic clustering and membrane translocation of the BcLOV4 photoreceptor. Pal AA, Benman W, Mumford TR, Huang Z, Chow BY, Bugaj LJ. Proc Natl Acad Sci U S A. 2023 Aug 8;120(32):e2221615120. doi: 10.1073/pnas.2221615120. Epub 2023 Aug 1. 10.1073/pnas.2221615120 PubMed 37527339