pAAV-CAG-mCherry-Tandem-PSAM4-GlyR
(Plasmid
#208361)
-
PurposeExpression of the inhibitory chemogenetic tool PSAM4-GlyR and mCherry reporter. Application of ultrapotent agonists induces neuronal silencing.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208361 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 7242
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-TANDEM-PSAM4-GlyR
-
Alt namemCherry-P2A-T2A-PSAM4-GlyR
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2142
- Promoter CAG
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer GCCTCTGCTAACCATGTTCATGCCTTCTTC
- 3′ sequencing primer GGCTGATCAGCGGGTTTAAAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byOriginal construct for PSAM4-GlyR was a gift from Scott Sternson (Addgene plasmid #119739) Magnus et al Science. 2019. All other parts were generated using gene fragment synthesis.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The tandem linker sequence (Furin-GSG-P2A-GSG-T2A) was first used by Lui et al 2017, PMID: 28526819
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-mCherry-Tandem-PSAM4-GlyR was a gift from David Bennett (Addgene plasmid # 208361 ; http://n2t.net/addgene:208361 ; RRID:Addgene_208361) -
For your References section:
A humanized chemogenetic system inhibits murine pain-related behavior and hyperactivity in human sensory neurons. Perez-Sanchez J, Middleton SJ, Pattison LA, Hilton H, Ali Awadelkareem M, Zuberi SR, Renke MB, Hu H, Yang X, Clark AJ, St John Smith E, Bennett DL. Sci Transl Med. 2023 Oct 4;15(716):eadh3839. doi: 10.1126/scitranslmed.adh3839. Epub 2023 Oct 4. 10.1126/scitranslmed.adh3839 PubMed 37792955