Skip to main content
Addgene
Open Menu

CRY2clust-mCherry-RANK
(Plasmid #208612)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208612 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 208612-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 208612-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCAG-WPRE/N1 (modified pEGFP-N1)
  • Backbone manufacturer
    Modified from Clontech
  • Backbone size w/o insert (bp) 5731
  • Total vector size (bp) 10486
  • Modifications to backbone
    CMV promoter was replaced by CAG promoter, the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) was inserted, and EGFP was removed.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CRY2clust-mCherry-RANK
  • Alt name
    Opto-RANKc
  • Species
    M. musculus (mouse), A. thaliana (mustard weed)
  • Insert Size (bp)
    3510
  • Entrez Gene
    Cry2 (a.k.a. D130054K12Rik)
  • Promoter CAG
  • Tag / Fusion Protein
    • mCherry

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer GCGTAAAAGGAGCAACATAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Won Do Heo (CRY2clust from mCherry-CRY2clust, Addgene ID 105624 ): One silent mutation at a KpnI site is introduced.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CRY2clust-mCherry-RANK was a gift from Tomohiro Ishii & Takao Nakata (Addgene plasmid # 208612 ; http://n2t.net/addgene:208612 ; RRID:Addgene_208612)

  • For your References section:

    Development of an optogenetics tool, Opto-RANK, for control of osteoclast differentiation using blue light. Takada A, Asano T, Nakahama KI, Ono T, Nakata T, Ishii T. Sci Rep. 2024 Jan 19;14(1):1749. doi: 10.1038/s41598-024-52056-w. 10.1038/s41598-024-52056-w PubMed 38242937
Related items:
Commonly requested with: