Skip to main content
Addgene

CRY2clust-mCherry-RANK-P2A-CIBNcaax
(Plasmid #208613)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208613 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG-WPRE/N1 (modified pEGFP-N1)
  • Backbone manufacturer
    Modified from Clontech
  • Backbone size w/o insert (bp) 5731
  • Total vector size (bp) 10486
  • Modifications to backbone
    CMV promoter was replaced by CAG promoter, the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) was inserted, and EGFP was removed.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CRY2clust-mCherry-RANK-P2A-CIBNcaax
  • Alt name
    Opto-RANKm
  • Species
    M. musculus (mouse), A. thaliana (mustard weed)
  • Insert Size (bp)
    4755
  • Entrez Gene
    Cry2 (a.k.a. D130054K12Rik)
  • Promoter CAG
  • Tags / Fusion Proteins
    • mCherry
    • CAAX (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer GCGTAAAAGGAGCAACATAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Won Do Heo (CRY2clust from mCherry-CRY2clust, Addgene ID 105624 ): One silent mutation at a KpnI site is introduced. Dr. Kai Zhang (P2A-CIBN-CIBN from OptoRaf, Addgene ID 207163): One silent mutation at an XhoI site is introduced.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CRY2clust-mCherry-RANK-P2A-CIBNcaax was a gift from Tomohiro Ishii & Takao Nakata (Addgene plasmid # 208613 ; http://n2t.net/addgene:208613 ; RRID:Addgene_208613)
  • For your References section:

    Development of an optogenetics tool, Opto-RANK, for control of osteoclast differentiation using blue light. Takada A, Asano T, Nakahama KI, Ono T, Nakata T, Ishii T. Sci Rep. 2024 Jan 19;14(1):1749. doi: 10.1038/s41598-024-52056-w. 10.1038/s41598-024-52056-w PubMed 38242937