Skip to main content

pDisplay-GRAB_CCK1.0
(Plasmid #208672)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208672 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDisplay
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 6546
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GPCR activation based cholecystokinin (CCK) sensor GRAB_CCK1.0
  • Alt name
    GRAB_CCK1.0
  • Alt name
    CCK1.0
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2127
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGGGCGGTAGGCGTGTA
  • 3′ sequencing primer CCTCACATTGCCAAAAGACG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDisplay-GRAB_CCK1.0 was a gift from Yulong Li (Addgene plasmid # 208672 ; http://n2t.net/addgene:208672 ; RRID:Addgene_208672)
  • For your References section:

    A tool kit of highly selective and sensitive genetically encoded neuropeptide sensors. Wang H, Qian T, Zhao Y, Zhuo Y, Wu C, Osakada T, Chen P, Chen Z, Ren H, Yan Y, Geng L, Fu S, Mei L, Li G, Wu L, Jiang Y, Qian W, Zhang L, Peng W, Xu M, Hu J, Jiang M, Chen L, Tang C, Zhu Y, Lin D, Zhou JN, Li Y. Science. 2023 Nov 17;382(6672):eabq8173. doi: 10.1126/science.abq8173. Epub 2023 Nov 17. 10.1126/science.abq8173 PubMed 37972184