Skip to main content

pKLV-EF1a-BFP-W
(Plasmid #208757)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208757 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKLV-EF1aGFP-W
  • Backbone manufacturer
    addgene
  • Backbone size (bp) 8743
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGTAATTCTCCTTGGAATTTG
  • 3′ sequencing primer CAAAGGGAGATCCGACTCGT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKLV-EF1a-BFP-W was a gift from Kosuke Yusa (Addgene plasmid # 208757 ; http://n2t.net/addgene:208757 ; RRID:Addgene_208757)
  • For your References section:

    Canonical BAF complex regulates the oncogenic program in human T-cell acute lymphoblastic leukemia. Aoki K, Hyuga M, Tarumoto Y, Nishibuchi G, Ueda A, Ochi Y, Sugino S, Mikami T, Kobushi H, Kato I, Akahane K, Inukai T, Takaori-Kondo A, Takita J, Ogawa S, Yusa K. Blood. 2023 Nov 3:blood.2023020857. doi: 10.1182/blood.2023020857. 10.1182/blood.2023020857 PubMed 37922452