pRSFDuet1_CoiA1_CoiB
(Plasmid
#208761)
-
PurposePrecursor peptide CoiA1 and synthase CoiB, for the co-expression of CoiA1 in E.coli.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208761 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRSFDuet1
- Total vector size (bp) 7352
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCoiA1
-
Alt nameprecursor lanthipeptide A1 on coi BGC
-
SpeciesSynthetic
-
Insert Size (bp)549
-
MutationChanged Ser 20 to Asn, Changed Arg 84 to Lys, both mutations on SUMO
- Promoter T7
-
Tags
/ Fusion Proteins
- Hisx6 Tag (N terminal on insert)
- SUMO (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer cggataacaattcccctgtag
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCoiB
-
Alt namelanthipeptide dehydratase CoiB
-
SpeciesSynthetic
-
Insert Size (bp)3099
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cggccgcataatcgaaat
- 3′ sequencing primer gctagttattgctcagcgg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.10.26.564210v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSFDuet1_CoiA1_CoiB was a gift from Wilfred van der Donk (Addgene plasmid # 208761 ; http://n2t.net/addgene:208761 ; RRID:Addgene_208761) -
For your References section:
Facile Method for Determining Lanthipeptide Stereochemistry. Luo Y, Xu S, Frerk AM, van der Donk WA. Anal Chem. 2024 Jan 30;96(4):1767-1773. doi: 10.1021/acs.analchem.3c04958. Epub 2024 Jan 17. 10.1021/acs.analchem.3c04958 PubMed 38232355