pETDuet1_CoiC_CoiSA
(Plasmid
#208762)
-
PurposeTwo coi synthase CoiC and CoiSA, for the co-expression of CoiA1 in E.coli.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepETDuet1
- Total vector size (bp) 8631
-
Modifications to backbonetriplet deletion (TAT) between A6187 and A6188 at the bom gene
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCoiC
-
Alt namecyclase CoiC
-
SpeciesSynthetic
-
Insert Size (bp)1260
-
Mutationsingle nucleotide insertion (C70) at RBS of CoiC
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer cctctagaaataattttgtttaac
- 3′ sequencing primer cgtgtacaatacgattactttc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCoiSA
-
Alt nameglutamyl lyase CoiSA
-
SpeciesSynthetic
-
Insert Size (bp)2091
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cacggccgcataatcgaaat
- 3′ sequencing primer ccgctgagcaataactagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.10.26.564210v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETDuet1_CoiC_CoiSA was a gift from Wilfred van der Donk (Addgene plasmid # 208762 ; http://n2t.net/addgene:208762 ; RRID:Addgene_208762) -
For your References section:
Facile Method for Determining Lanthipeptide Stereochemistry. Luo Y, Xu S, Frerk AM, van der Donk WA. Anal Chem. 2024 Jan 30;96(4):1767-1773. doi: 10.1021/acs.analchem.3c04958. Epub 2024 Jan 17. 10.1021/acs.analchem.3c04958 PubMed 38232355