phROSA26-Tet-HA-JSAP1_WT
(Plasmid
#208772)
-
PurposeTetracycline inducible expression vector for HA-JSAP1_WT, used as a donor plasmid for HA-JSAP1_WT knock-in at the human ROSA26 locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208772 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMK365
-
Backbone manufacturerAddgene #121185
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameJSAP1
-
Alt nameJIP3
-
Alt nameMAP8IP3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4023
-
Entrez GeneMAPK8IP3 (a.k.a. JIP-3, JIP3, JSAP1, NEDBA, SYD2, syd)
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTTTGCTTATGTAAACCAGG
- 3′ sequencing primer attaagggttattgaatatgatcgCCCCGAAAAGTGCCACCTGACGTCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
phROSA26-Tet-HA-JSAP1_WT was a gift from Katsuji Yoshioka (Addgene plasmid # 208772 ; http://n2t.net/addgene:208772 ; RRID:Addgene_208772) -
For your References section:
Overexpression of JNK-associated leucine zipper protein induces chromosomal instability through interaction with dynein light intermediate chain 1. Suzuki R, Kanemaki MT, Suzuki T, Yoshioka K. Genes Cells. 2023 Nov 14. doi: 10.1111/gtc.13083. 10.1111/gtc.13083 PubMed 37963657