Skip to main content

pGL-p21UTRm2
(Plasmid #20879)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 20879 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL3-Control
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5256
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p21 3'UTR site 2 mutation
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1300
  • Mutation
    Predicted miRNA binding site 2 (Position ~1100) GCACTTA to GCCCGTA
  • GenBank ID
    NM_007669
  • Entrez Gene
    Cdkn1a (a.k.a. CAP20, CDKI, CIP1, Cdkn1, P21, SDI1, Waf1, mda6, p21Cip1, p21WAF)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GGAAAACTCGACGCAAGA
  • 3′ sequencing primer CACATTTGTAGAGGTTTTACTTGCT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL-p21UTRm2 was a gift from Robert Blelloch (Addgene plasmid # 20879 ; http://n2t.net/addgene:20879 ; RRID:Addgene_20879)
  • For your References section:

    Embryonic stem cell-specific microRNAs regulate the G1-S transition and promote rapid proliferation. Wang Y, Baskerville S, Shenoy A, Babiarz JE, Baehner L, Blelloch R. Nat Genet. 2008 Dec . 40(12):1478-83. 10.1038/ng.250 PubMed 18978791