Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pGL-Lats2UTR
(Plasmid #20882)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 20882 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL3-Control
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5256
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lats2 3'UTR
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1600
  • GenBank ID
    NM_015771
  • Entrez Gene
    Lats2 (a.k.a. 4932411G09Rik, AV277261, AW228608)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GGAAAACTCGACGCAAGA
  • 3′ sequencing primer CACATTTGTAGAGGTTTTACTTGCT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A C->T mutation at nt530 in Addgene's sequence should not affect the function of this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL-Lats2UTR was a gift from Robert Blelloch (Addgene plasmid # 20882 ; http://n2t.net/addgene:20882 ; RRID:Addgene_20882)
  • For your References section:

    Embryonic stem cell-specific microRNAs regulate the G1-S transition and promote rapid proliferation. Wang Y, Baskerville S, Shenoy A, Babiarz JE, Baehner L, Blelloch R. Nat Genet. 2008 Dec . 40(12):1478-83. 10.1038/ng.250 PubMed 18978791