pNHA_OROV_Gc
(Plasmid
#208936)
-
PurposeExpresses N-terminally HA-tagged Oropouche orthobunyavirus Gc protein from CMV promoter in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV-HA
-
Backbone manufacturerChristopher A Walsh
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 6332
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGc
-
Alt nameG1, glycoprotein, envelope protein
-
SpeciesOropouche orthobunyavirus
-
Insert Size (bp)2532
-
MutationDeleted 1579 bp from 5' end, deleted 277 bp from 3' end and inserted stop codon so Gc expressed
-
GenBank IDNC_005775.1
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAGGAAACAGCTATGAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOROV genes were cloned from plasmids provided by Prof. Richard Elliott, University of Glasgow.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNHA_OROV_Gc was a gift from Gerald Barry (Addgene plasmid # 208936 ; http://n2t.net/addgene:208936 ; RRID:Addgene_208936)