Skip to main content

RC00214-pcsb-35Sp-ccdB-mNG-OCSp-tdT
(Plasmid #209019)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209019 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCsB (Plasmid #52136)
  • Backbone manufacturer
    Jim Haseloff
  • Backbone size w/o insert (bp) 6705
  • Total vector size (bp) 11475
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    ccdB
  • Species
    Synthetic
  • Insert Size (bp)
    4551

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SapI (destroyed during cloning)
  • 3′ cloning site SapI (destroyed during cloning)
  • 5′ sequencing primer acgtctacaaagcaagtgg
  • 3′ sequencing primer gtgaaagccttctgccactc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mNeonGreen
  • Species
    Synthetic
  • Mutation
    codon optimized for N. benthamiana
  • Promoter CaMV35S

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SapI (destroyed during cloning)
  • 3′ cloning site SapI (destroyed during cloning)
  • 5′ sequencing primer AGAGCACAAAGGGGGATCTT
  • 3′ sequencing primer gtgaaagccttctgccactc
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    tdTomato
  • Species
    Synthetic
  • Mutation
    codon optimized for N. benthamiana
  • Promoter Octopine Synthase

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site SapI (destroyed during cloning)
  • 3′ cloning site SapI (destroyed during cloning)
  • 5′ sequencing primer TGAAAGACGGAGGGCATTAC
  • 3′ sequencing primer GGAATGTCAGCAGGGTGTTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RC00214-pcsb-35Sp-ccdB-mNG-OCSp-tdT was a gift from Stephen Long (Addgene plasmid # 209019 ; http://n2t.net/addgene:209019 ; RRID:Addgene_209019)