RC00214-pcsb-35Sp-ccdB-mNG-OCSp-tdT
(Plasmid
#209019)
-
PurposeDual-fluorescence acceptor plasmid for one-step insertion of a 5' leader of interest between the CaMV35S promoter and mNeonGreen via BpiI. A tdTomato expression cassette serves as internal control.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209019 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCsB (Plasmid #52136)
-
Backbone manufacturerJim Haseloff
- Backbone size w/o insert (bp) 6705
- Total vector size (bp) 11475
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameccdB
-
SpeciesSynthetic
-
Insert Size (bp)4551
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (destroyed during cloning)
- 3′ cloning site SapI (destroyed during cloning)
- 5′ sequencing primer acgtctacaaagcaagtgg
- 3′ sequencing primer gtgaaagccttctgccactc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemNeonGreen
-
SpeciesSynthetic
-
Mutationcodon optimized for N. benthamiana
- Promoter CaMV35S
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (destroyed during cloning)
- 3′ cloning site SapI (destroyed during cloning)
- 5′ sequencing primer AGAGCACAAAGGGGGATCTT
- 3′ sequencing primer gtgaaagccttctgccactc
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nametdTomato
-
SpeciesSynthetic
-
Mutationcodon optimized for N. benthamiana
- Promoter Octopine Synthase
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (destroyed during cloning)
- 3′ cloning site SapI (destroyed during cloning)
- 5′ sequencing primer TGAAAGACGGAGGGCATTAC
- 3′ sequencing primer GGAATGTCAGCAGGGTGTTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RC00214-pcsb-35Sp-ccdB-mNG-OCSp-tdT was a gift from Stephen Long (Addgene plasmid # 209019 ; http://n2t.net/addgene:209019 ; RRID:Addgene_209019)