pCRISPR-cBEST-v2-PermE
(Plasmid
#209446)
-
Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site
-
Depositing Lab
-
Depositing OrganizationDanmarks Tekniske Universitet
Located in Denmark -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209446 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 209446-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 209446-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGM1190
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsmaintenance in streptomycetes at 30 C. Temperature sensitive pSG5 replicon, replication only below 37 C.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCodon optimized APOBEC1-nCas9-UGI fusion protein
-
Alt nameCytosine base editor
-
SpeciesSynthetic
-
Insert Size (bp)5100
- Promoter PtipA; sgRNA expression from ermE* promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCTTgcggtcgatcttgacg
- 3′ sequencing primer TGCTGACCGGATCAGCAGTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 209446-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 209446-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPR-cBEST-v2-PermE was a gift from Tilmann Weber (Addgene plasmid # 209446 ; http://n2t.net/addgene:209446 ; RRID:Addgene_209446) -
For your References section:
Biosynthesis of the Azoxy Compound Azodyrecin from Streptomyces mirabilis P8-A2. Maleckis M, Wibowo M, Gren T, Jarmusch SA, Sterndorff EB, Booth T, Henriksen NNSE, Whitford CM, Jiang X, Jorgensen TS, Ding L, Weber T. ACS Chem Biol. 2024 Feb 10. doi: 10.1021/acschembio.3c00632. 10.1021/acschembio.3c00632 PubMed 38340355
Map uploaded by the depositor.
