pGL4.23_Mmp11
(Plasmid
#209520)
-
PurposeExpresses luciferase under control of Mmp11 promoter in transfected cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209520 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL4.23
- Backbone size w/o insert (bp) 4283
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMmp11 promoter
-
Alt nameST3; SL-3; Stmy3; MMP-11
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)602
-
Entrez GeneMmp11 (a.k.a. MMP-11, SL-3, ST3, Stmy3)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer TGCCAAGTGTCAGTAGAGGTCAG
- 3′ sequencing primer CTGCTGGGCCTGCTGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4.23_Mmp11 was a gift from Jennifer Mitchell (Addgene plasmid # 209520 ; http://n2t.net/addgene:209520 ; RRID:Addgene_209520) -
For your References section:
SOX4 exerts contrasting regulatory effects on labor-associated gene promoters in myometrial cells. Khader N, Shchuka VM, Dorogin A, Shynlova O, Mitchell JA. PLoS One. 2024 Apr 18;19(4):e0297847. doi: 10.1371/journal.pone.0297847. eCollection 2024. 10.1371/journal.pone.0297847 PubMed 38635533