Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

LentiCRISPRv2-sgCTRL
(Plasmid #209750)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 209750 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 52961)
  • Backbone size w/o insert (bp) 14873
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • gRNA/shRNA sequence
    GTTCCGCGTTACATAACTTA
  • Species
    Synthetic

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LentiCRISPRv2-sgCTRL was a gift from Andrei Thomas-Tikhonenko (Addgene plasmid # 209750 ; http://n2t.net/addgene:209750 ; RRID:Addgene_209750)
  • For your References section:

    Alternative splicing of its 5' UTR limits CD20 mRNA translation and enables resistance to CD20-directed immunotherapies. Ang Z, Paruzzo L, Hayer KE, Schmidt C, Torres-Diz M, Xu F, Zankharia U, Zhang Y, Soldan SS, Zheng S, Falkenstein CD, Loftus JP, Yang SY, Asnani M, King Sainos P, Pillai V, Chong ER, Li M, Tasian SK, Barash Y, Lieberman PM, Ruella M, Schuster SJ, Thomas-Tikhonenko A. Blood. 2023 Sep 8:blood.2023020400. doi: 10.1182/blood.2023020400. 10.1182/blood.2023020400 PubMed 37683180