pCDH-V2-rCD20-BSD
(Plasmid
#209753)
-
PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209753 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDH-IRES-BSD
- Backbone size w/o insert (bp) 7456
-
Vector typeLentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMS4A1
-
SpeciesH. sapiens (human)
-
MutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the CDS of CD20 was mutated to GTTGGGCGGACTACTTATGATTC to confer resistance to the CD20-targeting gRNA from the LentiCRISPRv2-sgCD20 vector.
-
Entrez GeneMS4A1 (a.k.a. B1, Bp35, CD20, CVID5, FMC7, LEU-16, S7)
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Lentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 2 mRNA isoform of CD20. The "CCTGGGGGGTCTTCTGATGATCC" sequence within the CDS of MS4A1 was altered with synonymous substitutions to "GTTGGGCGGACTACTTATGATTC" to avoid recognition by the gRNA from LentiCRISPRv2-sgCD20. This allows for the rescue of CD20 expression after LentiCRISPRv2-sgCD20 vector-mediated knockout.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-V2-rCD20-BSD was a gift from Andrei Thomas-Tikhonenko (Addgene plasmid # 209753 ; http://n2t.net/addgene:209753 ; RRID:Addgene_209753) -
For your References section:
Alternative splicing of its 5' UTR limits CD20 mRNA translation and enables resistance to CD20-directed immunotherapies. Ang Z, Paruzzo L, Hayer KE, Schmidt C, Torres-Diz M, Xu F, Zankharia U, Zhang Y, Soldan SS, Zheng S, Falkenstein CD, Loftus JP, Yang SY, Asnani M, King Sainos P, Pillai V, Chong ER, Li M, Tasian SK, Barash Y, Lieberman PM, Ruella M, Schuster SJ, Thomas-Tikhonenko A. Blood. 2023 Sep 8:blood.2023020400. doi: 10.1182/blood.2023020400. 10.1182/blood.2023020400 PubMed 37683180