HOXA9-micro-MSCV
(Plasmid
#20976)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 20976 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneMSCV-PGK-GFP
- Backbone size w/o insert (bp) 6500
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHOXA9
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1000
-
MutationMutations to remove binding sites for miR-145, let-7, and miR-126 in homeobox.
-
Entrez GeneHoxa9 (a.k.a. D6a9, Hox-1.7)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer MSCV
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDebbie Wolgemuth
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutant seq for all 3 miRNa sites is 5'- ctggagttagagaaggagtttctgtttaacatgtatttaacacgggaccgcagatatgag
The nucleotide sequence should not change the aa sequence.
Has ribosomal recognition site (ACC) in front of the ATG protein coding start site.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HOXA9-micro-MSCV was a gift from Corey Largman (Addgene plasmid # 20976 ; http://n2t.net/addgene:20976 ; RRID:Addgene_20976) -
For your References section:
MicroRNA-126 regulates HOXA9 by binding to the homeobox. Shen WF, Hu YL, Uttarwar L, Passegue E, Largman C. Mol Cell Biol. 2008 Jul . 28(14):4609-19. 10.1128/MCB.01652-07 PubMed 18474618
Map uploaded by the depositor.