Skip to main content

HOXA9-micro-MSCV
(Plasmid #20976)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 20976 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MSCV-PGK-GFP
  • Backbone size w/o insert (bp) 6500
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HOXA9
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1000
  • Mutation
    Mutations to remove binding sites for miR-145, let-7, and miR-126 in homeobox.
  • Entrez Gene
    Hoxa9 (a.k.a. D6a9, Hox-1.7)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer MSCV
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Debbie Wolgemuth

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mutant seq for all 3 miRNa sites is 5'- ctggagttagagaaggagtttctgtttaacatgtatttaacacgggaccgcagatatgag

The nucleotide sequence should not change the aa sequence.

Has ribosomal recognition site (ACC) in front of the ATG protein coding start site.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HOXA9-micro-MSCV was a gift from Corey Largman (Addgene plasmid # 20976 ; http://n2t.net/addgene:20976 ; RRID:Addgene_20976)
  • For your References section:

    MicroRNA-126 regulates HOXA9 by binding to the homeobox. Shen WF, Hu YL, Uttarwar L, Passegue E, Largman C. Mol Cell Biol. 2008 Jul . 28(14):4609-19. 10.1128/MCB.01652-07 PubMed 18474618