This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

HOXA9-micro-MSCV
(Plasmid #20976)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 20976 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MSCV-PGK-GFP
  • Backbone size w/o insert (bp) 6500
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HOXA9
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1000
  • Mutation
    Mutations to remove binding sites for miR-145, let-7, and miR-126 in homeobox.
  • Entrez Gene
    Hoxa9 (a.k.a. D6a9, Hox-1.7)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer MSCV
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Mutant seq for all 3 miRNa sites is 5'- ctggagttagagaaggagtttctgtttaacatgtatttaacacgggaccgcagatatgag

The nucleotide sequence should not change the aa sequence.

Has ribosomal recognition site (ACC) in front of the ATG protein coding start site.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HOXA9-micro-MSCV was a gift from Corey Largman (Addgene plasmid # 20976 ; http://n2t.net/addgene:20976 ; RRID:Addgene_20976)
  • For your References section:

    MicroRNA-126 regulates HOXA9 by binding to the homeobox. Shen WF, Hu YL, Uttarwar L, Passegue E, Largman C. Mol Cell Biol. 2008 Jul . 28(14):4609-19. 10.1128/MCB.01652-07 PubMed 18474618