HOXA9-micro-MSCV
(Plasmid #20976)

• Depositing Lab: Corey Largman
• Publication: Shen et al Mol Cell Biol. 2008 Jul . 28(14):4609-19.

Backbone

• Vector backbone: MSCV-PGK-GFP
• Backbone size w/o insert (bp): 6500
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: GFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HOXA9
• Species: M. musculus (mouse)
• Insert Size (bp): 1000
• Mutation: Mutations to remove binding sites for miR-145, let-7, and miR-126 in homeobox.
• Entrez Gene: Hoxa9 (a.k.a. D6a9, Hox-1.7)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: MSCV

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Debbie Wolgemuth

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Mutant seq for all 3 miRNa sites is 5'- ctggagttagagaaggagtttctgtttaacatgtatttaacacgggaccgcagatatgag

The nucleotide sequence should not change the aa sequence.

Has ribosomal recognition site (ACC) in front of the ATG protein coding start site.