AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-OLLAS
(Plasmid
#209782)
-
PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA targeted the mouse Camk2d gene by U6 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209782 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV-U6-msCAMK2d-SgRNA-scaffold-cTNT-SaCas9-HA-OLLAS
- Backbone size w/o insert (bp) 7500
- Total vector size (bp) 7499
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA
-
Alt namesgRNA
-
SpeciesSynthetic
-
Insert Size (bp)21
- Promoter cTNT
-
Tags
/ Fusion Proteins
- HA (C terminal on backbone)
- OLLAS (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cttgaaagtatttcgatttcttggc
- 3′ sequencing primer cctctttgaacagccgcac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.06.29.546982v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-OLLAS was a gift from Yuxuan Guo (Addgene plasmid # 209782 ; http://n2t.net/addgene:209782 ; RRID:Addgene_209782) -
For your References section:
MicroRNA-122-Mediated Liver Detargeting Enhances the Tissue Specificity of Cardiac Genome Editing. Yang L, Liu Z, Chen G, Chen Z, Guo C, Ji X, Cui Q, Sun Y, Hu X, Zheng Y, Li Y, Gao F, Chen L, Zhou P, Pu WT, Guo Y. Circulation. 2024 May 28;149(22):1778-1781. doi: 10.1161/CIRCULATIONAHA.123.065438. Epub 2024 May 28. 10.1161/CIRCULATIONAHA.123.065438 PubMed 38805581