Skip to main content

pSCALPS-mAgo2-EGFP
(Plasmid #209935)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209935 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSCALPS
  • Backbone size w/o insert (bp) 7743
  • Total vector size (bp) 11674
  • Modifications to backbone
    EGFP added in frame of insert
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ago2
  • Alt name
    Eif2c2
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_153178
  • Entrez Gene
    Ago2 (a.k.a. 1110029L17Rik, 2310051F07Rik, Eif2c2, Gerp95, Gm10365, mKIAA4215)
  • Promoter SFFV
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GAGGCCAAGAACAGATGGTCC
  • 3′ sequencing primer CAACGAGAAGCGCGATCACATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSCALPS-mAgo2-EGFP was a gift from Phillip Zamore (Addgene plasmid # 209935 ; http://n2t.net/addgene:209935 ; RRID:Addgene_209935)
  • For your References section:

    Principles and pitfalls of high-throughput analysis of microRNA-binding thermodynamics and kinetics by RNA Bind-n-Seq. Jouravleva K, Vega-Badillo J, Zamore PD. Cell Rep Methods. 2022 Mar 18;2(3):100185. doi: 10.1016/j.crmeth.2022.100185. eCollection 2022 Mar 28. 10.1016/j.crmeth.2022.100185 PubMed 35475222