pSCALPS-mAgo2-EGFP
(Plasmid
#209935)
-
PurposeLentiviral expression of mouse Argonaute-2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209935 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSCALPS
- Backbone size w/o insert (bp) 7743
- Total vector size (bp) 11674
-
Modifications to backboneEGFP added in frame of insert
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAgo2
-
Alt nameEif2c2
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_153178
-
Entrez GeneAgo2 (a.k.a. 1110029L17Rik, 2310051F07Rik, Eif2c2, Gerp95, Gm10365, mKIAA4215)
- Promoter SFFV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAGGCCAAGAACAGATGGTCC
- 3′ sequencing primer CAACGAGAAGCGCGATCACATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCALPS-mAgo2-EGFP was a gift from Phillip Zamore (Addgene plasmid # 209935 ; http://n2t.net/addgene:209935 ; RRID:Addgene_209935) -
For your References section:
Principles and pitfalls of high-throughput analysis of microRNA-binding thermodynamics and kinetics by RNA Bind-n-Seq. Jouravleva K, Vega-Badillo J, Zamore PD. Cell Rep Methods. 2022 Mar 18;2(3):100185. doi: 10.1016/j.crmeth.2022.100185. eCollection 2022 Mar 28. 10.1016/j.crmeth.2022.100185 PubMed 35475222