pSCALPS-mAgo2-EGFP
(Plasmid #209935)

• Purpose: Lentiviral expression of mouse Argonaute-2 in mammalian cells
• Depositing Lab: Phillip Zamore
• Publication: Jouravleva et al Cell Rep Methods. 2022 Mar 18;2(3):100185. doi: 10.1016/j.crmeth.2022.100185. eCollection 2022 Mar 28.

Backbone

• Vector backbone: pSCALPS
• Backbone size w/o insert (bp): 7743
• Total vector size (bp): 11674
• Modifications to backbone: EGFP added in frame of insert
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ago2
• Alt name: Eif2c2
• Species: M. musculus (mouse)
• GenBank ID: NM_153178
• Entrez Gene: Ago2 (a.k.a. 1110029L17Rik, 2310051F07Rik, Eif2c2, Gerp95, Gm10365, mKIAA4215)
• Promoter: SFFV
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GAGGCCAAGAACAGATGGTCC
• 3′ sequencing primer: CAACGAGAAGCGCGATCACATG

Resource Information

• Supplemental Documents:
  • pscALPS-puro-EGFP-mAgo2.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry