TfR-SpyCatcher003(K31TAG)-sfGFP-MycTag-CTag
(Plasmid #210021)

• Purpose: Expression of transferrin receptor transmembrane domain and photocaged SpyCatcher003(K31HCK)-sfGFP on mammalian cell surface.
• Depositing Lab: Vesa Hytönen
• Publication: Rahikainen et al J Am Chem Soc. 2023 Nov 15;145(45):24459-24465. doi: 10.1021/jacs.3c07827. Epub 2023 Oct 31.

Backbone

• Vector backbone: Modified pcDNA3 (1xU6-PylT, 1xH1-PylT)
• Backbone manufacturer: Described in PMID: 33069552
• Backbone size w/o insert (bp): 5959
• Modifications to backbone: One copy of Desulfitobacterium hafniense pyrrolysyl-tRNACUA (PylT) with G8U under the control of a U6 promoter (1× U6-PylT) and one copy of Methanosarcina barkeri PylT with U25C under the control of a H1 promoter (1× H1-PylT)
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Transferrin receptor transmembrane domain-SpyCatcher003(K31TAG)-superfolderGFP-MycTag-CTag
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 1407
• Mutation: Transferrin receptor transmembrane domain with Y20C and F23A mutations to block internalization. SpyCatcher003 with K31TAG (Amber stop codon) mutation to allow incorporation of unnatural amino acids.
• Entrez Gene: TFRC (a.k.a. CD71, IMD46, T9, TFR, TFR1, TR, TRFR, p90)
• Promoter: CMV promoter
• Tag / Fusion Protein:
  • MycTag, CTag

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg
• 3′ sequencing primer: accctaactgacacacattcc

Resource Information

• Supplemental Documents:
  • TfR-SpyCatcher(K31TAG)-sfGFP-MycTag-Ctag.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry