TfR-SpyCatcher003(K31TAG)-sfGFP-MycTag-CTag
(Plasmid
#210021)
-
PurposeExpression of transferrin receptor transmembrane domain and photocaged SpyCatcher003(K31HCK)-sfGFP on mammalian cell surface.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210021 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneModified pcDNA3 (1xU6-PylT, 1xH1-PylT)
-
Backbone manufacturerDescribed in PMID: 33069552
- Backbone size w/o insert (bp) 5959
-
Modifications to backboneOne copy of Desulfitobacterium hafniense pyrrolysyl-tRNACUA (PylT) with G8U under the control of a U6 promoter (1× U6-PylT) and one copy of Methanosarcina barkeri PylT with U25C under the control of a H1 promoter (1× H1-PylT)
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTransferrin receptor transmembrane domain-SpyCatcher003(K31TAG)-superfolderGFP-MycTag-CTag
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1407
-
MutationTransferrin receptor transmembrane domain with Y20C and F23A mutations to block internalization. SpyCatcher003 with K31TAG (Amber stop codon) mutation to allow incorporation of unnatural amino acids.
-
Entrez GeneTFRC (a.k.a. CD71, IMD46, T9, TFR, TFR1, TR, TRFR, p90)
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- MycTag, CTag
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer accctaactgacacacattcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TfR-SpyCatcher003(K31TAG)-sfGFP-MycTag-CTag was a gift from Vesa Hytönen (Addgene plasmid # 210021 ; http://n2t.net/addgene:210021 ; RRID:Addgene_210021) -
For your References section:
Visible Light-Induced Specific Protein Reaction Delineates Early Stages of Cell Adhesion. Rahikainen R, Vester SK, Turkki P, Janosko CP, Deiters A, Hytonen VP, Howarth M. J Am Chem Soc. 2023 Nov 15;145(45):24459-24465. doi: 10.1021/jacs.3c07827. Epub 2023 Oct 31. 10.1021/jacs.3c07827 PubMed 38104267