SpyTag003(V114T, V116T)-Talin rod-mCherry
(Plasmid
#210027)
-
PurposeExpression of SpyTag003(V114T, V116T)-Talin rod(434-2541)-mCherry in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 210027 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3964
- Total vector size (bp) 11053
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpyTag003(V114T,V116T)-Talin1 rod domain(434-2541)-mCherry
-
SpeciesM. musculus (mouse), Synthetic
-
Insert Size (bp)7089
-
MutationSpyTag003 V114T and V116T mutations to modify SpyCatcher003 association rate. These mutations do not block isopeptide bond formation.
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acgcaaatgggcggtagg
- 3′ sequencing primer GATGAGTTTGGACAAACCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SpyTag003(V114T, V116T)-Talin rod-mCherry was a gift from Vesa Hytönen (Addgene plasmid # 210027 ; http://n2t.net/addgene:210027 ; RRID:Addgene_210027) -
For your References section:
Visible Light-Induced Specific Protein Reaction Delineates Early Stages of Cell Adhesion. Rahikainen R, Vester SK, Turkki P, Janosko CP, Deiters A, Hytonen VP, Howarth M. J Am Chem Soc. 2023 Nov 15;145(45):24459-24465. doi: 10.1021/jacs.3c07827. Epub 2023 Oct 31. 10.1021/jacs.3c07827 PubMed 38104267