pCB-1
(Plasmid
#210387)
-
PurposeAll-in-one cumate-based inducible CRISPRi plasmid for use in Streptomyces
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210387 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTHS
-
Backbone manufacturerChunbo Lou
- Backbone size w/o insert (bp) 6468
- Total vector size (bp) 13194
-
Vector typeCRISPR ; Integrative vector for use in Streptomyces
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namedCas9
-
Alt nameCodon optimized SpdCas9
-
Insert Size (bp)4107
-
MutationThe BsaI sites were removed via synonymous mutations
- Promoter SP30
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer tctaagtaaggagtgtccat (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCymR
-
Alt nameCymR repressor
-
SpeciesPseudomonas putida
-
Insert Size (bp)616
- Promoter SP11
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer cctaacgaggagatcggttc (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namesgRNA cassette
-
SpeciesSynthetic
-
Insert Size (bp)1379
-
MutationBsaI-flanked RFP cassette inserted in place of spacer
- Promoter SP30
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer caagcggtgatagactaatc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byWe received the backbone as a gift from Prof. Chunbo Lou (Shenzhen Institute of Advanced Technology, Chinese Academy of Sciences).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCB-1 was a gift from Gilles van Wezel (Addgene plasmid # 210387 ; http://n2t.net/addgene:210387 ; RRID:Addgene_210387) -
For your References section:
CUBIC: A Versatile Cumate-Based Inducible CRISPRi System in Streptomyces. Bai C, van Wezel GP. ACS Synth Biol. 2023 Oct 6. doi: 10.1021/acssynbio.3c00464. 10.1021/acssynbio.3c00464 PubMed 37801665