Membrane mCherry
(Plasmid
#210470)
-
PurposePlasma membrane localizing mCherry using Human LCK proto-oncogene sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210470 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2+8
- Backbone size w/o insert (bp) 4137
- Total vector size (bp) 4909
-
Vector typeSynthetic Biology ; sea urchin, mammal, zebrafish
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLCK membrane mCherry
-
Alt nameLCK proto-oncogene, Src family tyrosine kinase
-
SpeciesH. sapiens (human), Synthetic; A.victoria
-
Insert Size (bp)828
-
Entrez GeneLCK (a.k.a. IMD22, LSK, YT16, p56lck, pp58lck)
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGACGTAAATGGGCGGTAGG
- 3′ sequencing primer GTCATAGCTGTTTCCTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTwist Bioscience
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Membrane mCherry was a gift from Amro Hamdoun (Addgene plasmid # 210470 ; http://n2t.net/addgene:210470 ; RRID:Addgene_210470)